View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16771_low_10 (Length: 202)

Name: NF16771_low_10
Description: NF16771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16771_low_10
NF16771_low_10
[»] chr5 (1 HSPs)
chr5 (14-183)||(6221615-6221784)


Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 14 - 183
Target Start/End: Complemental strand, 6221784 - 6221615
Alignment:
Q  14 gcagagatgcttttgaaacatgagtttatctcaggtgatgaaactgtttcattggtgaaagagttgatgaatgagttgccattgtcaatatcaccatctc 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  6221784 gcagagatgcttttgaaacatgagtttatctcaggtgatgaaactgtttcattggtgaaagagttgatcaatgagttgccattgtcaatatcaccatctc 6221685  T
Q  114 cgagaactcacttcgattttcctcattgggcttcttctagtgttacgactttgcctcctgatgcaaagga 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6221684 cgagaactcacttcgattttcctcattgggcttcttctagtgttacgactttgcctcctgatgcaaagga 6221615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University