View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16768_low_64 (Length: 215)

Name: NF16768_low_64
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16768_low_64
NF16768_low_64
[»] chr7 (1 HSPs)
chr7 (15-197)||(42246486-42246668)


Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 42246486 - 42246668
Alignment:
Q  15 agcaaaggactcatatgatgtggttgggttggatctacaatggttctttcaaatattgaagagaagagaacaagaaaacacggagaaaacaaaaacaatg 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  42246486 agcaaaggactcatatgatgtggttgggttggatctacaatggttctttcaaatattgaagagaagagaacaagaaaacacggagaaagcaaaaacaatg 42246585  T
Q  115 gagagaatatcataaggggcaacacactttaaaactgaaagtaatcctatggcatgctataaaccatgaaatttagtgtttac 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42246586 gagagaatatcataaggggcaacacactttaaaactgaaagtaatcctatggcatgctataaaccatgaaatttagtgtttac 42246668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University