View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16768_low_52 (Length: 246)

Name: NF16768_low_52
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16768_low_52
NF16768_low_52
[»] chr1 (1 HSPs)
chr1 (79-224)||(34120766-34120911)


Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 79 - 224
Target Start/End: Original strand, 34120766 - 34120911
Alignment:
Q  79 atattatatgatgagttgatacacatgggctgaaagagtcatggctgatgatgagtctataagccactcaattgttttaccaatgggaccctttcatatt 178  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34120766 atattatatgatgagttgatacacatgggctgaaagagtcatggctgatgatgagtctataagccactcaattgttttaccaatgggaccctttcatatt 34120865  T
Q  179 gatgatagcaagaaattcacaacattatgatccatcataaacatta 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  34120866 gatgatagcaagaaattcacaacattatgatccatcataaacatta 34120911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University