View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16768_low_31 (Length: 362)

Name: NF16768_low_31
Description: NF16768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16768_low_31
NF16768_low_31
[»] chr7 (2 HSPs)
chr7 (81-182)||(42859345-42859446)
chr7 (272-355)||(42859540-42859618)


Alignment Details
Target: chr7 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 81 - 182
Target Start/End: Original strand, 42859345 - 42859446
Alignment:
Q  81 taatcgaaatttacattaacctctcttcaagatactagcgggcttgaacccaaaactttcaaatttaacatccatctttttaccactaaattaaacctag 180  Q
    ||||||||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  42859345 taatcgaaatttacattaacctctcttgaagatactagcgggtttgaacccaagactttcaaatttaacatccatctttttaccactaaattaaacctag 42859444  T
Q  181 ag 182  Q
    ||    
T  42859445 ag 42859446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 272 - 355
Target Start/End: Original strand, 42859540 - 42859618
Alignment:
Q  272 tttcattttggtcacttagcttaaaaatatcagatgttttgatcttttaaactataaaatttagatatttcggtcattcatatc 355  Q
    |||||||||||||||||| ||||||||||| |||||||||||||||||||     ||||| |||| ||||||||||||||||||    
T  42859540 tttcattttggtcacttaacttaaaaatattagatgttttgatcttttaa-----aaaatgtagacatttcggtcattcatatc 42859618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University