View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16767_high_13 (Length: 256)

Name: NF16767_high_13
Description: NF16767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16767_high_13
NF16767_high_13
[»] chr8 (1 HSPs)
chr8 (1-234)||(3907232-3907465)


Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 3907232 - 3907465
Alignment:
Q  1 tagacccgcgtctagcgagcggataccctaatacctagcttctcaaattcatggaaaaatatgacattgcgcggttttgtaattgccgtagtttcctaat 100  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||    
T  3907232 tagacccgcgtctagcgagcggatgccctaatacctagcttctcaaattcatggaaaaatatgacattgcgcggttttgtaatcgccttagtttcctaat 3907331  T
Q  101 gtgaatccaaacacacatttcaaatgagtgtgttgaggcttgtgttatctcttttcgtgggatcatttggtggtgttgttcgaggggatatatgtttggc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||    
T  3907332 gtgaatccaaacacacatttcaaatgagtgtgttgaggcttgtgttatctcttttcgtgggatcatttggttttgttgttcgaggggatatatgtttggc 3907431  T
Q  201 gtctttgttggtttttctggtggttatgtatgat 234  Q
    ||||||||||||||||||||||||||||||||||    
T  3907432 gtctttgttggtttttctggtggttatgtatgat 3907465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University