View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16766_low_7 (Length: 443)

Name: NF16766_low_7
Description: NF16766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16766_low_7
NF16766_low_7
[»] chr8 (1 HSPs)
chr8 (18-89)||(24941928-24941999)


Alignment Details
Target: chr8 (Bit Score: 64; Significance: 8e-28; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 18 - 89
Target Start/End: Original strand, 24941928 - 24941999
Alignment:
Q  18 gggatcaataatgccctgaatatagtgaatgatgcgcttcaatgccgacatatgttgtatttttggattacg 89  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||    
T  24941928 gggatcaataatgccctgaatatagtgaatgacgcgcttcaatgccgacatatgttgtgtttttggattacg 24941999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University