View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16765_low_28 (Length: 213)

Name: NF16765_low_28
Description: NF16765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16765_low_28
NF16765_low_28
[»] chr7 (1 HSPs)
chr7 (9-198)||(25179590-25179779)
[»] chr4 (1 HSPs)
chr4 (64-104)||(4776542-4776582)


Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 9 - 198
Target Start/End: Original strand, 25179590 - 25179779
Alignment:
Q  9 gagtagcaaaggtggttttggtgggtctttgggaacgtggcttgatgtagcatgaagggattgaggttaggccactttcagctaaggcttggactcgaac 108  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25179590 gagtagcaaaagtggttttggtgggtctttgggaacgtggcttgatgtagcatgaagggattgaggttaggccactttcagctaaggcttggactcgaac 25179689  T
Q  109 tataggctctggccatgcttgggcacaactcatcattttctcttttgggtgtgtttgtgtttcacttttgggttatagatagatgaaact 198  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25179690 tataggctctggccatgcttgggcacaactcatcattttttcttttgggtgtgtttgtgtttcacttttgggttatagatagatgaaact 25179779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 104
Target Start/End: Complemental strand, 4776582 - 4776542
Alignment:
Q  64 agggattgaggttaggccactttcagctaaggcttggactc 104  Q
    |||||||||| ||| ||||||||||||||||||||||||||    
T  4776582 agggattgagcttatgccactttcagctaaggcttggactc 4776542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University