View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16758_high_58 (Length: 201)

Name: NF16758_high_58
Description: NF16758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16758_high_58
NF16758_high_58
[»] chr1 (1 HSPs)
chr1 (10-185)||(51341936-51342111)


Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 10 - 185
Target Start/End: Complemental strand, 51342111 - 51341936
Alignment:
Q  10 catcatcagtacttttattcacctcagttattctcccttcaacttggaggttaacaggaggttatgtgtattcgaggataacaaggatgacaataggata 109  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  51342111 catcatcggtacttttattcacctcagttattctcccttcaacttggaggttaacaggaggttatgtgtattcgaggataacaaggatgacaataggata 51342012  T
Q  110 cttgttcctttatgcctctgctttggtcatgggtctgttttctactatgtctggtgttgttttggtctatgatttc 185  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  51342011 cttgttcctttatgcctctgctttggtcatgggtttgttttctactatgtctggtgttgttttggtctatgatttc 51341936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University