View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16757_low_82 (Length: 217)

Name: NF16757_low_82
Description: NF16757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16757_low_82
NF16757_low_82
[»] chr7 (2 HSPs)
chr7 (84-200)||(40662249-40662365)
chr7 (89-200)||(40675791-40675902)


Alignment Details
Target: chr7 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 84 - 200
Target Start/End: Complemental strand, 40662365 - 40662249
Alignment:
Q  84 aagaatctctgattgattaagaagattgctcttgcacattgtagccattctttatttgctctgcaattcatattactatttgtatacatggatgattgtg 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40662365 aagaatctctgattgattaagaagattgctcttgcacattgtagccattctttatttgctctgcaattcatattactatttgtatacatggatgattgtg 40662266  T
Q  184 agtggtggttaattaca 200  Q
    |||||||||||||||||    
T  40662265 agtggtggttaattaca 40662249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 89 - 200
Target Start/End: Complemental strand, 40675902 - 40675791
Alignment:
Q  89 tctctgattgattaagaagattgctcttgcacattgtagccattctttatttgctctgcaattcatattactatttgtatacatggatgattgtgagtgg 188  Q
    |||||| ||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  40675902 tctctggttgattaagaagattgcacttgcacattgcagccattctttatctgctctgcaattcatattactatttgtatacatggatgattgtgagtgg 40675803  T
Q  189 tggttaattaca 200  Q
    ||||||||||||    
T  40675802 tggttaattaca 40675791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University