View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16751_high_55 (Length: 310)

Name: NF16751_high_55
Description: NF16751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16751_high_55
NF16751_high_55
[»] chr8 (1 HSPs)
chr8 (18-278)||(14195886-14196146)


Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 278
Target Start/End: Original strand, 14195886 - 14196146
Alignment:
Q  18 aataggatctggaatgatagttataatgatgcaatgattccaaggccttattatcattgcatatctctaaaatatttgcaatcatttatctcataaaaat 117  Q
    |||| |||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14195886 aatacgatctggactgatagtaataatgatgcaatgattccaaggccttattatcattgcatatctctaaaatatttgcaatcatttatctcataaaaat 14195985  T
Q  118 ccaaaaatactactttttattggcacactgaggagaacaagatagtgttgagattcacattttctatgggatcgatatttttattacgacagtaaaatca 217  Q
    |||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||     
T  14195986 ccaaaaatactactatttattggcacactgaggagaacaaaatagtgtcgagattcacattttctgtgggatcgatatttttattacgacagtaaaatcg 14196085  T
Q  218 tgcacttgcgaacatagagtttttagtattgttgtgggggacttgttgaatatcggggtga 278  Q
    ||||||||||  |||||||||||||||||||||||||||||||||||||| ||||||||||    
T  14196086 tgcacttgcggtcatagagtttttagtattgttgtgggggacttgttgaaaatcggggtga 14196146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University