View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16745_high_14 (Length: 220)

Name: NF16745_high_14
Description: NF16745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16745_high_14
NF16745_high_14
[»] chr3 (1 HSPs)
chr3 (14-205)||(37386620-37386811)


Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 205
Target Start/End: Original strand, 37386620 - 37386811
Alignment:
Q  14 caattaattcgatatatcttcccatcacttccatcattaatttaccagagcttattgaccaatataacttggttaaatgtttgaaatattaatggaatct 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  37386620 caattaattcgatatatcttcccatcacttccatcattaatttaccagagctcattgaccaatataacttggttaaatgtttgaaatattaatggaatct 37386719  T
Q  114 tggtttttaggtgaatgagttgttgggaatcataattatgtttttgagagcctagctagcctatacggtgagagtaatgtgcttttaaagta 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37386720 tggtttttaggtgaatgagttgttgggaatcataattatgtttttgagagcctagctagcctatacggtgagagtaatgtgcttttaaagta 37386811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University