View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16742_low_20 (Length: 260)

Name: NF16742_low_20
Description: NF16742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16742_low_20
NF16742_low_20
[»] chr2 (1 HSPs)
chr2 (19-242)||(15821764-15821989)


Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 15821989 - 15821764
Alignment:
Q  19 taaaaaagctagcttcttgcattagggagagtttggggtcttgattttgtgaaatatgccttcttt--ctctctctctttcttttacttaaataccttgg 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
T  15821989 taaaaaagctagcttcttgcattagggagagtttggggtcttgattttgtgaaatatgccttctttttctctctctctttcttttacttaaataccttgg 15821890  T
Q  117 ccaactaccagttcatatcttgctggaattttttagcatgaaccatatttagtcttttggctactccatttgtactatataatcttaatagctgcatcat 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  15821889 ccaactaccagttcatatcttgctggaattttttagcatgaaccatatttagtcttttggctactccatttgtactatataatcttaataactgcatcat 15821790  T
Q  217 tttttagaaagttcttctgttgcttc 242  Q
    | ||||||||||||||| ||||||||    
T  15821789 tctttagaaagttcttcagttgcttc 15821764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University