View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16741_low_69 (Length: 240)

Name: NF16741_low_69
Description: NF16741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16741_low_69
NF16741_low_69
[»] chr5 (2 HSPs)
chr5 (1-129)||(40576000-40576128)
chr5 (188-219)||(40575974-40576005)


Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 40576128 - 40576000
Alignment:
Q  1 ttgaattttcttacttttcttcatgcaccaaggaatgagatgatacagcatttagaggaagacttttcaatattcgtgaaaaagttgatataagaagggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40576128 ttgaattttcttacttttcttcatgcaccaaggaatgagatgatacagcatttagaggaagacttttcaatattcgtgaaaaagttgatataagaagggt 40576029  T
Q  101 attgtcgatcaacctagctcatgcttcag 129  Q
    |||| ||||||||||||||||||||||||    
T  40576028 attgccgatcaacctagctcatgcttcag 40576000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 188 - 219
Target Start/End: Complemental strand, 40576005 - 40575974
Alignment:
Q  188 cttcagctcaagtgttgatatacaccagattg 219  Q
    ||||||||||||||||||||||||||||||||    
T  40576005 cttcagctcaagtgttgatatacaccagattg 40575974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University