View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16740_low_5 (Length: 286)

Name: NF16740_low_5
Description: NF16740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16740_low_5
NF16740_low_5
[»] chr7 (2 HSPs)
chr7 (22-152)||(36026431-36026563)
chr7 (214-266)||(36026317-36026369)
[»] chr1 (1 HSPs)
chr1 (27-145)||(16933824-16933951)


Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 22 - 152
Target Start/End: Complemental strand, 36026563 - 36026431
Alignment:
Q  22 cttacaaatacaaaaacagaaattaaacaggctatgtatccagacaagtttcatacttatccaactggggttgaaaaatggcatcatc--atattcagaa 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||    
T  36026563 cttacaaatacaaaaacagaaattaaacaggctatgtatccagacaagtttcatacttatccaactggggttgaaaaatggcatcatcatatattcagaa 36026464  T
Q  120 cgagccctgatttttcaaaatgaacttaactgc 152  Q
    |||||||||||||||||||||||||||||||||    
T  36026463 cgagccctgatttttcaaaatgaacttaactgc 36026431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 214 - 266
Target Start/End: Complemental strand, 36026369 - 36026317
Alignment:
Q  214 ccaggtaaggataaggttggatgatccaatagggaagtgcagagaagcctagg 266  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36026369 ccaggtaaggataaggttggatgatccaatagggaagtgcagagaagcctagg 36026317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 27 - 145
Target Start/End: Original strand, 16933824 - 16933951
Alignment:
Q  27 aaatacaaaaacagaaattaaacaggctatgtatccagacaagtttcatacttatccaactggggttgaaaaatggcatc---------atcatattcag 117  Q
    |||||||||||   |||| |||||||||||| |||||||||| ||| ||| ||||||||||  || |||||||||||| |         |||||||||||    
T  16933824 aaatacaaaaaagaaaataaaacaggctatgaatccagacaaatttaatagttatccaactatggctgaaaaatggcagcatatcatatatcatattcag 16933923  T
Q  118 aacgagccctgatttttcaaaatgaact 145  Q
    ||| ||| ||| ||||||||||||||||    
T  16933924 aacaagcactggtttttcaaaatgaact 16933951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University