View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16739_low_13 (Length: 271)

Name: NF16739_low_13
Description: NF16739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16739_low_13
NF16739_low_13
[»] chr4 (1 HSPs)
chr4 (16-256)||(47899806-47900045)


Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 16 - 256
Target Start/End: Original strand, 47899806 - 47900045
Alignment:
Q  16 ataattgttgctgtttaaaaaagcaataaagaatgattattatagaaattatcaacaaatgaatagtgagcaaagtgaaagaatcataattaatcatgaa 115  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  47899806 ataattgttgctgtttaacaaagcaataaagaatgattattatagaaattatcaacaaatgaatagtgagcaaagtgaaataatcataattaatcatgaa 47899905  T
Q  116 agtataaagcattacaaagaggaatataccttgcatagtaggcagcgacggcagccaagtagacagagtgaatccatttaggggaagtgctatgaaacgc 215  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47899906 agtataaagcattacaa-gaggaatataccttgcatagtaggcagcgacggcagccaagtagacagagtgaatccatttaggggaagtgctatgaaacgc 47900004  T
Q  216 aaccttccataactgaacatgcttaaccatgaatttatatt 256  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  47900005 aaccttccataactgaacatgcttaaccatgaatttatatt 47900045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University