View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16735_low_83 (Length: 268)

Name: NF16735_low_83
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16735_low_83
NF16735_low_83
[»] chr5 (1 HSPs)
chr5 (15-252)||(41548699-41548936)


Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 15 - 252
Target Start/End: Original strand, 41548699 - 41548936
Alignment:
Q  15 aggacaaaagaagaagcttggtggggaagatgaaatgagtgagtgagtgagttttggttgaaaatagagctatttgtgactgtgctgtgagtaaggaaag 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41548699 aggacaaaagaagaagcttggtggggaagatgaaatgagtgagtgagtgagttttggttgaaaatagagctatttgtgactgtgctgtgagtaaggaaag 41548798  T
Q  115 gaggatgaaaaaagatgtttggttaatatgtggaaggatatgattgaggaagatatgacgatgaaaggaagaagagaaaagcgattatagaaggagaaaa 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41548799 gaggatgaaaaaagatgtttggttaatatgtggaaggatatgattgaggaagatatgacgatgaaaggaagaagagaaaagcgattatagaaggagaaaa 41548898  T
Q  215 caaacaacattaacctatgatcttttaacaatttttgt 252  Q
    ||||||||||||||||||||||||||||||||||||||    
T  41548899 caaacaacattaacctatgatcttttaacaatttttgt 41548936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University