View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16735_low_124 (Length: 206)

Name: NF16735_low_124
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16735_low_124
NF16735_low_124
[»] chr6 (1 HSPs)
chr6 (136-190)||(31085317-31085371)


Alignment Details
Target: chr6 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 136 - 190
Target Start/End: Original strand, 31085317 - 31085371
Alignment:
Q  136 agaactcattaagaaacttgtatgctgattttaccgagaattcacattttttatt 190  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  31085317 agaactcattaagaaacttgtatgccgattttaccgagaattcacattttttatt 31085371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University