View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16735_low_120 (Length: 209)

Name: NF16735_low_120
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16735_low_120
NF16735_low_120
[»] chr4 (1 HSPs)
chr4 (59-192)||(19275348-19275481)


Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 59 - 192
Target Start/End: Original strand, 19275348 - 19275481
Alignment:
Q  59 tttttatctcttggttatcaagtttttctcttgtgaattgatgtactagttttaccaagtgaaaacttttaagtttcagcttcaaggaagatgataaaga 158  Q
    |||| |||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19275348 ttttcatcttttggtaatcaagtttttctcttgtgaattgatttactagttttaccaagtgaaaacttttaagtttcagcttcaaggaagatgataaaga 19275447  T
Q  159 tctgaaccttgatcataactttgcatgcatggct 192  Q
    ||||||||||||||||||||||||||||||||||    
T  19275448 tctgaaccttgatcataactttgcatgcatggct 19275481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University