View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16734_low_5 (Length: 266)

Name: NF16734_low_5
Description: NF16734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16734_low_5
NF16734_low_5
[»] chr1 (1 HSPs)
chr1 (17-258)||(44136741-44136980)


Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 258
Target Start/End: Original strand, 44136741 - 44136980
Alignment:
Q  17 agatatctcaacttggagccgagaagctgcaccaaattacagacatctaatccggaaacaatgcgnnnnnnntagaggagttccgcaatgctatgtgtga 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||       |||| |||||||||||||||||||||||    
T  44136741 agatatctcaacttggagccgagaagctgcaccaaattacagacatctaatccggaaacaacgcgaaaaaaatagaagagttccgcaatgctatgtgtga 44136840  T
Q  117 tggtaacgacccgcaattggaaagtatgcagaaaaatctcgcttctctaattctacaagaggaaacttactggcgtcaacgttctaaggtctattggtta 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  44136841 tggtaacgacccgcaattggaaagtatgcagaaaaatctcgcttctttaattctacaagaggaaacttactggcatcaacgttctaaggtctattggtta 44136940  T
Q  217 gcagacggcgacactaatagcaagttcttccatgcctatgct 258  Q
    | |||||  |||||||||||||||||||||||||||| ||||    
T  44136941 gtagacg--gacactaatagcaagttcttccatgcctctgct 44136980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University