View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16733_high_16 (Length: 283)

Name: NF16733_high_16
Description: NF16733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16733_high_16
NF16733_high_16
[»] chr5 (1 HSPs)
chr5 (49-271)||(4229859-4230082)


Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 49 - 271
Target Start/End: Complemental strand, 4230082 - 4229859
Alignment:
Q  49 ggagaataaaaatggaagttttataaaatttattgcaataattaattaaaatgnnnnnnnnnn-ctatagcaaacctaaaatatgataggttgcaaaaat 147  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||||||||||||||||||    
T  4230082 ggagaataaaaatggaagttttataaaatttattgcaataattaattaaaatgtttttttttttctatagcaaacctaaaatatgataggttgcaaaaat 4229983  T
Q  148 aaagcataaaaccaatatacccagaaatgnnnnnnnnnnnnnnnnnnnnnnnnagtccttaaaaagaacaccnnnnnnncacaaacaataactagaattg 247  Q
    |||||||||||||||||||||||||||||                        |||||||||||||||||||       |||||||||||||||||||||    
T  4229982 aaagcataaaaccaatatacccagaaatgtttttttttttttcctttctttttagtccttaaaaagaacaccaaaaaaacacaaacaataactagaattg 4229883  T
Q  248 aagggattgatgtatatgttatag 271  Q
    ||||||||||||||||||||||||    
T  4229882 aagggattgatgtatatgttatag 4229859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University