View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16732_low_52 (Length: 234)

Name: NF16732_low_52
Description: NF16732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16732_low_52
NF16732_low_52
[»] chr3 (1 HSPs)
chr3 (16-217)||(32536012-32536213)


Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 217
Target Start/End: Complemental strand, 32536213 - 32536012
Alignment:
Q  16 tatactgaattgaaactgcatacataattgagttgagtgcttgagttggttcagcgatgtaagcgggagcaattatttggaagtacaaagttctgagttg 115  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32536213 tatactgaattgaaactgcatgcataattgagttgagtgcttgagttggttcagcgatgtaagcgggagcaattatttggaagtacaaagttctgagttg 32536114  T
Q  116 tgatcacagcacactcacccgtcaccatttacttacccgatatcaaacaaaaaacaaaacccaattcacgagggctctctattcctttctgacacccttc 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32536113 tgatcacagcacactcacccgtcaccatttacttacccgatatcaaacaaaaaacaaaacccaattcacgagggctctctattcctttctgacacccttc 32536014  T
Q  216 ct 217  Q
    ||    
T  32536013 ct 32536012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University