View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16727_low_39 (Length: 244)

Name: NF16727_low_39
Description: NF16727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16727_low_39
NF16727_low_39
[»] chr3 (1 HSPs)
chr3 (1-195)||(27702117-27702311)


Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 27702311 - 27702117
Alignment:
Q  1 ttaggttatgaaaccattcatatgtattcataggacatttagtcaagaagtttagaatgtcataccaataataatcctttcgacctctttttgttccgga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27702311 ttaggttatgaaaccattcatatgtattcataggacatttagtcaagaagtttagaatgtcataccaataataatcctttcgacctctttttgttccgga 27702212  T
Q  101 ataactctaaacaagcttctagttgcaggaattcctcaacgaaaaggatggtaattactccaagcaactatagaatggcataccaaacactacac 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||    
T  27702211 ataactctaaacaagcttctagttgcaggaattcctcaacgaaaaggatggtaattactccaagcaactttagaatgtcataccaaacactacac 27702117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University