View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16727_low_35 (Length: 258)

Name: NF16727_low_35
Description: NF16727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16727_low_35
NF16727_low_35
[»] chr7 (1 HSPs)
chr7 (20-147)||(1116656-1116783)


Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 20 - 147
Target Start/End: Original strand, 1116656 - 1116783
Alignment:
Q  20 atatggacatcatgattcatgatgtatgattaatacttttattttcaggtagagtaataatatatgtagaggattgatctatgtaaaggatagctttttc 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1116656 atatggacatcatgattcatgatgtatgattaatacttttattttcaggtagagtaataatatatgtagaggattgatctatgtaaaggatagctttttc 1116755  T
Q  120 ccttcaaaataatcctgacgtggctttg 147  Q
    ||||||||||||||||||||||||||||    
T  1116756 ccttcaaaataatcctgacgtggctttg 1116783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University