View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16727_low_20 (Length: 350)

Name: NF16727_low_20
Description: NF16727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16727_low_20
NF16727_low_20
[»] chr3 (2 HSPs)
chr3 (278-333)||(25730666-25730721)
chr3 (157-205)||(25730794-25730842)


Alignment Details
Target: chr3 (Bit Score: 52; Significance: 9e-21; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 278 - 333
Target Start/End: Complemental strand, 25730721 - 25730666
Alignment:
Q  278 cactcgatcaaacgtttcttgcgtcacaaactaagattggtggatacataactatc 333  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  25730721 cactcgatcaaacgtttcttgcgtcacaaactaagatttgtggatacataactatc 25730666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 25730842 - 25730794
Alignment:
Q  157 ctattctcacaagataaaattgttgaacgaatggtgtaggtaagtcacc 205  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||    
T  25730842 ctatactcacaagataaaattgttgaacgaatggtgtaggtaagtcacc 25730794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University