View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16723_low_6 (Length: 203)

Name: NF16723_low_6
Description: NF16723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16723_low_6
NF16723_low_6
[»] chr2 (1 HSPs)
chr2 (17-203)||(44706630-44706816)


Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 203
Target Start/End: Original strand, 44706630 - 44706816
Alignment:
Q  17 gaaccatgcatgtgttgtatggccatctccacttgaaatgtcgggtgaaaaaataaatgccaagttatgccaaaattgaattcccattagttaaggatct 116  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44706630 gaaccatgcatgggttgtatggccatctccacttgaaatgtcgggtgaaaaaataaatgccaagttatgccaaaattgaattcccattagttaaggatct 44706729  T
Q  117 tctaaacaaaacaacaaaaaaggtttgtctagagaatacttagctccttctaaaaaatagaataggaaggagaatgcttagctacat 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||||||||||||||    
T  44706730 tctaaacaaaacaacaaaaaaggtttgtctagagaatacttagctccttttaaaaaatagaaaaagaaggagaatgcttagctacat 44706816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University