View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16722_high_27 (Length: 204)

Name: NF16722_high_27
Description: NF16722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16722_high_27
NF16722_high_27
[»] chr8 (1 HSPs)
chr8 (112-188)||(23956596-23956672)


Alignment Details
Target: chr8 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 112 - 188
Target Start/End: Complemental strand, 23956672 - 23956596
Alignment:
Q  112 gttaaatttattttgtgcagttctgggacatctggaggtgagagaaagttgatgccaacaattgaagaagagttagg 188  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23956672 gttaaatttattttgtgcagttctgggacatctggaggtgagagaaagttgatgccaacaattgaagaagagttagg 23956596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University