View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16720_high_22 (Length: 261)

Name: NF16720_high_22
Description: NF16720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16720_high_22
NF16720_high_22
[»] chr1 (1 HSPs)
chr1 (7-244)||(3487106-3487352)


Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 244
Target Start/End: Complemental strand, 3487352 - 3487106
Alignment:
Q  7 ataccaatatcgaacgcatatacagcgcgaacacttcttggttgcatgagaagcacaaacag---------gctcatcggagttaagaacaccgtgcatt 97  Q
    ||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||         ||||||||||||||||||||||| |||||    
T  3487352 ataccaatatcgaacgcctttacagcgcgaacacttcttggtggcatgagaagcacaaacagcacaaacaggctcatcggagttaagaacaccgggcatt 3487253  T
Q  98 gtggaggtgggagaagaaggatgatgatctccttcgaaattagcgtcgacttcgaagtatttagaagcggtgtttttgacaagagtgtgtaatccaatag 197  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3487252 ggggaggtgggagaagaaggatgatgatctccttcgaaattagcgtcgacttcgaagtatttagaagcggtgtttttgacaagagtgtgtaatccaatag 3487153  T
Q  198 cgattacaagagcggtgaatatgaattgaaggaatcgattgagatcc 244  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  3487152 cgattacaagagcggtgaatatgaattgaaggaatcgattgagatcc 3487106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University