View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16720_high_17 (Length: 324)

Name: NF16720_high_17
Description: NF16720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16720_high_17
NF16720_high_17
[»] chr5 (1 HSPs)
chr5 (284-317)||(17623064-17623097)


Alignment Details
Target: chr5 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 317
Target Start/End: Original strand, 17623064 - 17623097
Alignment:
Q  284 aaccaaaaacctcgacattccaccttttcatctc 317  Q
    ||||||||||||||||||||||||||||||||||    
T  17623064 aaccaaaaacctcgacattccaccttttcatctc 17623097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University