View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16715_low_12 (Length: 212)

Name: NF16715_low_12
Description: NF16715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16715_low_12
NF16715_low_12
[»] chr3 (1 HSPs)
chr3 (115-212)||(8821909-8822006)


Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 115 - 212
Target Start/End: Original strand, 8821909 - 8822006
Alignment:
Q  115 agtactaacgtcatattgaaaatgttaccccaccatgtcaagcaccggcaacaccacatggttaatgacagtaaaacacagagcgcaataatacccac 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8821909 agtactaacgtcatattgaaaatgttaccccaccatgtcaagcaccggcaacaccacatggttaatgacagtaaaacacagagcgcaataatacccac 8822006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University