View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16715_high_5 (Length: 382)

Name: NF16715_high_5
Description: NF16715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16715_high_5
NF16715_high_5
[»] chr2 (1 HSPs)
chr2 (250-366)||(14776910-14777026)


Alignment Details
Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 250 - 366
Target Start/End: Original strand, 14776910 - 14777026
Alignment:
Q  250 aaagacaagatgataaaagtgtttgaaatgattttatggtgattttggtgaagaaggaataaaaagttgaaaggcaattgcaagaaactaattgatagct 349  Q
    ||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||    
T  14776910 aaagacaagatgataaaagtgattgtaatgattttatggtgattttggtgaagaaggaataaaaagttgaaagacaattgcaagaaacaaattcatagct 14777009  T
Q  350 caattgaaaattgaaat 366  Q
    |||||||||||||||||    
T  14777010 caattgaaaattgaaat 14777026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University