View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16714_high_30 (Length: 248)

Name: NF16714_high_30
Description: NF16714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16714_high_30
NF16714_high_30
[»] chr8 (2 HSPs)
chr8 (35-211)||(6925312-6925487)
chr8 (151-209)||(8368855-8368913)


Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 35 - 211
Target Start/End: Complemental strand, 6925487 - 6925312
Alignment:
Q  35 tgttaatcttggagtgcccgatctctttctcatgtcccgaaaggaaatattgatgcaaaaatgaactgacaaannnnnnngtgcattccattcaaataac 134  Q
    |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||       |||||||||||||||||| |    
T  6925487 tgttaatcttggagtgtccgatctctttctcatgtcc-gaaaggaaatattgatgcaaaaatgaactgacaaatttttgtgtgcattccattcaaatacc 6925389  T
Q  135 aaatcagatgcataagcataatggtgatagaaataattgttagaatataacaatgttgatattattgtagtttatct 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6925388 aaatcagatgcataagcataatggtgatagaaataattgttagaatataacaatgttgatattattgtagtttatct 6925312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 209
Target Start/End: Complemental strand, 8368913 - 8368855
Alignment:
Q  151 cataatggtgatagaaataattgttagaatataacaatgttgatattattgtagtttat 209  Q
    ||||| ||||||||||||||| |||||||||||||||  |||||||  || ||||||||    
T  8368913 cataacggtgatagaaataatcgttagaatataacaaatttgatatctttctagtttat 8368855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University