View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16713_low_3 (Length: 209)

Name: NF16713_low_3
Description: NF16713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16713_low_3
NF16713_low_3
[»] chr3 (1 HSPs)
chr3 (108-191)||(44886593-44886676)
[»] chr8 (1 HSPs)
chr8 (31-82)||(55635-55686)


Alignment Details
Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 108 - 191
Target Start/End: Complemental strand, 44886676 - 44886593
Alignment:
Q  108 acaccttcgacttggagaatctggctatgagactgttggtccagtcaccgttctccttgatgtgaacgctaaggtagtcatccc 191  Q
    ||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44886676 acaccttcgacttggagaattcttttatgagactgttggtccagtcaccgttctccttgatgtgaacgctaaggtagtcatccc 44886593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 31 - 82
Target Start/End: Original strand, 55635 - 55686
Alignment:
Q  31 ttaattatatattctctctaattaattgcaccatatcatttatcttcataac 82  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  55635 ttaattatatattctctctaattaattgcaccatatcatttatcttcataac 55686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University