View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16712_high_18 (Length: 227)

Name: NF16712_high_18
Description: NF16712
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16712_high_18
NF16712_high_18
[»] chr5 (2 HSPs)
chr5 (144-227)||(42463663-42463746)
chr5 (18-95)||(42463537-42463614)


Alignment Details
Target: chr5 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 144 - 227
Target Start/End: Original strand, 42463663 - 42463746
Alignment:
Q  144 gtgactgaagtgtaatgaaaatgtgattattcattcagagtgtacttggcattatacttggaggtggtgctggtactcgtctat 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42463663 gtgactgaagtgtaatgaaaatgtgattattcattcagagtgtacttggcattatacttggaggtggtgctggtactcgtctat 42463746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 18 - 95
Target Start/End: Original strand, 42463537 - 42463614
Alignment:
Q  18 cttcatagctacattgtaattgctatcagaagaaaataatttttggtttctcttgtagattgaattgaaatatgtgaa 95  Q
    ||||||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42463537 cttcatagctataatgtaattgttatcagaagaaaataatttttggtttctcttgtagattgaattgaaatatgtgaa 42463614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University