View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16711_low_14 (Length: 216)

Name: NF16711_low_14
Description: NF16711
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16711_low_14
NF16711_low_14
[»] chr7 (2 HSPs)
chr7 (1-205)||(37717799-37718003)
chr7 (62-97)||(1662662-1662697)
[»] chr4 (1 HSPs)
chr4 (61-97)||(2843601-2843637)


Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 37718003 - 37717799
Alignment:
Q  1 catcagtgttatcaaatagcggctatagcagaactgtaatgctttaacacagtggaactcaaacaaatcactattgttctgcgatgcgctatttagttca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37718003 catcagtgttatcaaatagcggctatagcagaactgtaatgctttaacacagtggaactcaaacaaatcactattgttctgcgatgcgctatttagttca 37717904  T
Q  101 gagtgtttcaaatggctgcgctatagtcaatccgtgattgacaacactgttgtctatttatgtttatcatcattactttatgtgacagatagatattgtt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  37717903 gagtgtttcaaatggctgcgctatagtcaatccgtgattgacaacactgttgtctatttatgtttatcatcattactttatgtgacagatagacattgtt 37717804  T
Q  201 ctgtg 205  Q
    |||||    
T  37717803 ctgtg 37717799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 97
Target Start/End: Complemental strand, 1662697 - 1662662
Alignment:
Q  62 aacaaatcactattgttctgcgatgcgctatttagt 97  Q
    ||||||||| ||||||||||||||||||||||||||    
T  1662697 aacaaatcattattgttctgcgatgcgctatttagt 1662662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 97
Target Start/End: Complemental strand, 2843637 - 2843601
Alignment:
Q  61 aaacaaatcactattgttctgcgatgcgctatttagt 97  Q
    ||||||||||||||||||||||||| | |||||||||    
T  2843637 aaacaaatcactattgttctgcgatacactatttagt 2843601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University