View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16709_low_11 (Length: 254)

Name: NF16709_low_11
Description: NF16709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16709_low_11
NF16709_low_11
[»] chr5 (1 HSPs)
chr5 (14-149)||(7558878-7559013)


Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 14 - 149
Target Start/End: Complemental strand, 7559013 - 7558878
Alignment:
Q  14 cttccatggttagagaacttgctatgagagtgagagcttttgagagtgtgctttgagaggtggtggttgtcgttttacggtgaggataagatattcggaa 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  7559013 cttccatggttagagaacttgctatgagagtgagagcttttgagagtgtgctttgagaggtggtggttgtcgttttacagtgaggataagatattcggaa 7558914  T
Q  114 atagataattttagaataaataatcaatttctcttc 149  Q
    ||||||||||||||||||||||||||||||||||||    
T  7558913 atagataattttagaataaataatcaatttctcttc 7558878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University