View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16704_low_8 (Length: 279)

Name: NF16704_low_8
Description: NF16704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16704_low_8
NF16704_low_8
[»] chr1 (2 HSPs)
chr1 (8-162)||(4238130-4238284)
chr1 (50-99)||(4252465-4252514)


Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 8 - 162
Target Start/End: Original strand, 4238130 - 4238284
Alignment:
Q  8 ccaagaatattacaataacgtaaaatatgaaaccgaaaataaatgaaagctcacacaaaacttttctttaattcaccatagtaaatgcaggagtaatgca 107  Q
    |||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  4238130 ccaaaaatattacaacaacgtaaaatatgaaaccgaaaataaatgaaagctcacacaaaacttttctttaattcaccatagtaaatgcaggtgtaatgca 4238229  T
Q  108 acacaaaccttattttggttgtgctgcatgtaaatctgcttgatttcacaactaa 162  Q
    | |||||||||||||||||||||||| || |||||||||||||||||||||||||    
T  4238230 aaacaaaccttattttggttgtgctgtatttaaatctgcttgatttcacaactaa 4238284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 50 - 99
Target Start/End: Original strand, 4252465 - 4252514
Alignment:
Q  50 atgaaagctcacacaaaacttttctttaattcaccatagtaaatgcagga 99  Q
    ||||||| ||||||||||||||| ||||||||| |||| || ||||||||    
T  4252465 atgaaagttcacacaaaacttttatttaattcagcataatagatgcagga 4252514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University