View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16702_high_62 (Length: 253)

Name: NF16702_high_62
Description: NF16702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16702_high_62
NF16702_high_62
[»] chr5 (1 HSPs)
chr5 (20-231)||(35557442-35557654)


Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 20 - 231
Target Start/End: Complemental strand, 35557654 - 35557442
Alignment:
Q  20 atgctacaactaaaatatcatgtatgcttaagt-ataatgtgtcactaactcactgttgttttgacaaatgctatactctaaagcttcaacaaaattaca 118  Q
    ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||| ||||||||||||||||||||||||||||    
T  35557654 atgctacaactaaaatatcatgtatgcttaagttataatgtgtcagtaactcactgttgttttgacgaatgttatactctaaagcttcaacaaaattaca 35557555  T
Q  119 gtgttgccgtaatttcatcaaaatcaccttgatttccacatgcaccgaaacacaggtagattttatttgcaacttctctttttatccactggtttgaact 218  Q
     |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35557554 atgttgccgtaatttcatcaaaatcaccttgatttccacatgcactgaaacacaggtagattttatttgcaacttctctttttatccactggtttgaact 35557455  T
Q  219 acacaccaaatca 231  Q
    |||||||||||||    
T  35557454 acacaccaaatca 35557442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University