View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16698_low_11 (Length: 348)

Name: NF16698_low_11
Description: NF16698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16698_low_11
NF16698_low_11
[»] chr7 (1 HSPs)
chr7 (65-331)||(5821300-5821570)


Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 65 - 331
Target Start/End: Complemental strand, 5821570 - 5821300
Alignment:
Q  65 cgttacggtgatgagttaatgcatcattatactttgaatgtggatgaaactttgtgttgatggaagagt----gaggtttcatttttatttgaagtaact 160  Q
    ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    ||||||| |||||||||||||||||||    
T  5821570 cgttatggtaatgagttaatgcatcattatactttgaatgtggatgaaactttgtgttggtggaagagtaagtgaggttttatttttatttgaagtaact 5821471  T
Q  161 cgctactaacattatgttaatcctacgtcttccgggccagctaacttgcaacattcggacggtactgaaggtgggtttagtcgggtggattggttccaga 260  Q
     ||||||| ||||||||||||||||||||| ||||||||| ||||| |||||||| | ||||||||||| ||||||||||||||||||||||||||||||    
T  5821470 tgctactagcattatgttaatcctacgtctgccgggccagataactcgcaacatttgaacggtactgaacgtgggtttagtcgggtggattggttccaga 5821371  T
Q  261 aacccctatggaagtgcagccccatcctattctaagtaaagtggtgcaagatgatattgcggcaattcacc 331  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  5821370 aacccctatggaagtgcagccccatcctattctaagtaaagtggtgcaagatgatactgcggcaattcacc 5821300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University