View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16697_low_47 (Length: 214)

Name: NF16697_low_47
Description: NF16697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16697_low_47
NF16697_low_47
[»] chr7 (1 HSPs)
chr7 (21-197)||(43536226-43536402)


Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 21 - 197
Target Start/End: Complemental strand, 43536402 - 43536226
Alignment:
Q  21 atggttcccaaaaagaaacacaaaaattggaacacttaattagcataatttctaatattttgggtgtccgttaataacacgtatggaaaatgtgaagcta 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43536402 atggttcccaaaaagaaacacaaaaattggaacacttaattagcataatttctaatattttgggtgtccgttaataacacgtatggaaaatgtgaagcta 43536303  T
Q  121 attaattagtgaatttgctcttgcttattgattgataggaaaccaccataatttcgttgatatttggtattcccaca 197  Q
    ||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||| | ||||||||    
T  43536302 attaattagtgaatttgctcttatttattgattgataggaaaccaccataatttcgttgatatttgcttttcccaca 43536226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University