View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16697_low_32 (Length: 253)

Name: NF16697_low_32
Description: NF16697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16697_low_32
NF16697_low_32
[»] chr8 (2 HSPs)
chr8 (46-234)||(37630795-37630993)
chr8 (1-32)||(37630992-37631023)


Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 46 - 234
Target Start/End: Complemental strand, 37630993 - 37630795
Alignment:
Q  46 attcgagttgatttaattaaggttttaatgtgtgattaacgaaagatgattagatcaataaaatgaagaattagaatta----------taatgaaaacc 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||          |||||||||||    
T  37630993 attcgagttgatttaattaaggttttaatgtgtgattaacgaaaggtgattagatcaataaaatgaagaattagaattagagagaattataatgaaaacc 37630894  T
Q  136 ttgaacggagccgatttccttctcgaccttggcatgcatttcacgaagagcagcggcttcttcttccatttccttcaagcggcgcctcatctcatcgag 234  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  37630893 ttgaacggagccaatttccttctcgaccttggcatgcatttcacgaagagcagcggcttcttcttccatttccttcaagcggcgcctcatctcgtcgag 37630795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 37631023 - 37630992
Alignment:
Q  1 attatatagtgaggaagatgattgcatgcaat 32  Q
    ||||||||||||||||||||||||||||||||    
T  37631023 attatatagtgaggaagatgattgcatgcaat 37630992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University