View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16695_low_12 (Length: 311)

Name: NF16695_low_12
Description: NF16695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16695_low_12
NF16695_low_12
[»] chr3 (2 HSPs)
chr3 (18-176)||(43588687-43588844)
chr3 (241-311)||(43588552-43588622)


Alignment Details
Target: chr3 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 18 - 176
Target Start/End: Complemental strand, 43588844 - 43588687
Alignment:
Q  18 caatcattttgaggagggaataacttatcatcaactgttctttcttataagaatacacaacagctaaaatgaataataattacgactagctaaaatgtca 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |    
T  43588844 caatcattttgaggagggaataacttatcatcaactgttctttcttataaaaatacacaacagctaaaatgaataacaattacgactagctaaaatgtaa 43588745  T
Q  118 tgaaataataaatgaagaacctctattgccagtaaaatttgttttcagttgtccaaccc 176  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  43588744 tgaaataataaatgaagaacctctattgccagtaaaatttg-tttcagttgtccaaccc 43588687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 241 - 311
Target Start/End: Complemental strand, 43588622 - 43588552
Alignment:
Q  241 gtttactatccaatgaatatgcttctttgattatgcaaccaaccaaatgcagctgaaaaaactagtttacc 311  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43588622 gtttactatccaatgaatatgcttctttgattatgcaaccaaccaaatgcagctgaaaaaactagtttacc 43588552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University