View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16691_low_5 (Length: 291)

Name: NF16691_low_5
Description: NF16691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16691_low_5
NF16691_low_5
[»] chr5 (2 HSPs)
chr5 (168-273)||(41735068-41735178)
chr5 (18-103)||(41735244-41735339)


Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 168 - 273
Target Start/End: Complemental strand, 41735178 - 41735068
Alignment:
Q  168 atcaataacaaacgaggattataatagagatgaacatgttatg-----aatggacctttcgaacatgctagcgatataatgagtgtgtaattttttgttg 262  Q
    |||||||||||||||||||||||||||||||||||||||||||     ||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  41735178 atcaataacaaacgaggattataatagagatgaacatgttatgttatgaatggacctttcggacatgctagcgatataatgagtgtgtaattttttgttg 41735079  T
Q  263 aagggagtgta 273  Q
    |||| ||||||    
T  41735078 aaggcagtgta 41735068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 18 - 103
Target Start/End: Complemental strand, 41735339 - 41735244
Alignment:
Q  18 cttatgtctatgcaataataacatacacatgcttccatcaatcg----------taattggttaggctagtacattgattggtatgaaattgctta 103  Q
    |||||||||||||||||||||||||||||||||||||||| |||          ||||||||||||||||||||||||||||||||||||||||||    
T  41735339 cttatgtctatgcaataataacatacacatgcttccatcactcgtaatatggcataattggttaggctagtacattgattggtatgaaattgctta 41735244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University