View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16687_low_4 (Length: 258)

Name: NF16687_low_4
Description: NF16687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16687_low_4
NF16687_low_4
[»] chr2 (1 HSPs)
chr2 (58-171)||(43628766-43628877)
[»] chr3 (1 HSPs)
chr3 (1-37)||(42613145-42613180)


Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 58 - 171
Target Start/End: Original strand, 43628766 - 43628877
Alignment:
Q  58 ggtggatcctatctctcttgaaattgcaacaattagnnnnnnnnttataaatgaggagaatgttaatccaaggaagaagatgatgaaggaacaaatcaca 157  Q
    ||||||||||||||||||| |||||| |||||||||        |||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  43628766 ggtggatcctatctctcttcaaattgaaacaattagaaaaaa--ttataaatgaggaggatgttaatccaaggaagaagatgatgaaggaacaaatcaca 43628863  T
Q  158 tgtctttcactaaa 171  Q
    ||||||||||||||    
T  43628864 tgtctttcactaaa 43628877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 42613180 - 42613145
Alignment:
Q  1 tttataaatttttttcatttgttgcaatttgaagaga 37  Q
    |||||||||||||| ||||||||||||||||||||||    
T  42613180 tttataaatttttt-catttgttgcaatttgaagaga 42613145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University