View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16682_low_20 (Length: 236)

Name: NF16682_low_20
Description: NF16682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16682_low_20
NF16682_low_20
[»] chr4 (1 HSPs)
chr4 (3-165)||(45790068-45790230)


Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 3 - 165
Target Start/End: Complemental strand, 45790230 - 45790068
Alignment:
Q  3 gtgtccatgcaaatgctactcaattggtagctgcactaacgttgataatcccatatactgctccaaatttaatgtgtgagtatagcactaggctacttga 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||    
T  45790230 gtgtccatgcaaatgctactcaattggtagctgcactaacgttgataatcccatatactgctccaaacttaatgtgtgagtatggcactaggctacttga 45790131  T
Q  103 tcnnnnnnnnnnnnnccaattcaagttgtgttgtctaggagcaacttaaagataaagacacaa 165  Q
    |              ||||||||||||||||||||||||||||||||||||| ||||||||||    
T  45790130 taaaaaaagaaaaaaccaattcaagttgtgttgtctaggagcaacttaaagacaaagacacaa 45790068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University