View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16676_low_47 (Length: 222)

Name: NF16676_low_47
Description: NF16676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16676_low_47
NF16676_low_47
[»] chr1 (1 HSPs)
chr1 (18-209)||(52376075-52376266)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 52376075 - 52376266
Alignment:
Q  18 atttcgcatgctattgttgctttgcctgctttgttgtttctatcacttgcttttgcctgcataacattttgggctgtggggcttgatggtggattctcag 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52376075 atttcgcatgctattgttgctttgcctgctttgttgtttctatcacttgcttttgcctgcataacattttgggctgtggggcttgatggtggattctcag 52376174  T
Q  118 gttttttgttttactttgttatcattcttgcttcattttgggccgggaactcgttcgtttcgtttctttcaggtgtggttcctcatgtgatg 209  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  52376175 gttttttgttttactttgttatcattcttgcttcattttgggcagggaactcgttcgtttcgtttctttcaggtgtggttcctcatgtgatg 52376266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University