View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16675_low_19 (Length: 239)

Name: NF16675_low_19
Description: NF16675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16675_low_19
NF16675_low_19
[»] chr7 (1 HSPs)
chr7 (28-197)||(42946768-42946937)


Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 28 - 197
Target Start/End: Original strand, 42946768 - 42946937
Alignment:
Q  28 attcacaaggtgatcatttatttgtcttgctaatgtgataggggttttgatttggaaaataataaatatgcctacttaactatgaattaaatatgagatt 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42946768 attcacaaggtgatcatttatttgtcttgctaatgtgataggggttttgatttggaaaataataaatatgcctacttaactatgaattaaatatgagatt 42946867  T
Q  128 ttgaagatcttgtctttaatgacaaatacaagtaggagctcagctcatatgacagcagagcaagactaaa 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42946868 ttgaagatcttgtctttaatgacaaatacaagtaggagctcagctcatatgacagcagagcaagactaaa 42946937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University