View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16673_low_4 (Length: 345)

Name: NF16673_low_4
Description: NF16673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16673_low_4
NF16673_low_4
[»] chr7 (3 HSPs)
chr7 (13-245)||(33942226-33942445)
chr7 (239-307)||(33942465-33942532)
chr7 (298-341)||(33942533-33942576)


Alignment Details
Target: chr7 (Bit Score: 161; Significance: 8e-86; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 33942226 - 33942445
Alignment:
Q  13 tcatcaactctttgcaatgaaaattcataatcaaattagtcagcttgaaattataagctaaataaatatcttagttgaaaaggtccaacaaaatcaaatt 112  Q
    |||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33942226 tcatcaactctttgaaatgaaaattcataattaaattagtcagcttgaaattataagctaaataaatatcttagttgaaaaggtccaacaaaatcaaatt 33942325  T
Q  113 actgaaacaacaatagtagattgattatagaaaaatactacggatatgcctgcctcttttgctttcgagcttcttcatccccctcatgcaatttttgtag 212  Q
    ||| |||||||||||||||||||||| ||              |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33942326 actcaaacaacaatagtagattgattgta-------------tatatgcttgcctcttttgctttcgagcttcttcatccccctcatgcaatttttgtag 33942412  T
Q  213 tctctcttttactcccaactgaagacaatactt 245  Q
    |||||||||||| ||||||||||||||||||||    
T  33942413 tctctcttttacccccaactgaagacaatactt 33942445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 239 - 307
Target Start/End: Original strand, 33942465 - 33942532
Alignment:
Q  239 aatactttctcttcatactccatctgcaaagtctatcattaaaagattgattatggcaagatatgtaat 307  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33942465 aatactttctcttc-tactccatctgcaaagtctatcattaaaagattgattatggcaagatatgtaat 33942532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 298 - 341
Target Start/End: Original strand, 33942533 - 33942576
Alignment:
Q  298 gatatgtaatcctcaccatatgactaagccgcttcatctctctc 341  Q
    |||||||||||||| |||||||||||||||||| | ||||||||    
T  33942533 gatatgtaatcctcgccatatgactaagccgctccttctctctc 33942576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University