View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16668_low_21 (Length: 411)

Name: NF16668_low_21
Description: NF16668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16668_low_21
NF16668_low_21
[»] chr2 (2 HSPs)
chr2 (205-285)||(36942372-36942453)
chr2 (54-94)||(36942333-36942373)


Alignment Details
Target: chr2 (Bit Score: 54; Significance: 7e-22; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 205 - 285
Target Start/End: Original strand, 36942372 - 36942453
Alignment:
Q  205 gggctgagcttttttaataaattttgccaactttaga-aagaaaaacttgctgctatttattttttatgtgcttgtgtgtgt 285  Q
    |||||||||||||| ||||||||||||||| || | | ||||||||||||||||||||||||||||||| ||||||||||||    
T  36942372 gggctgagctttttaaataaattttgccaatttaaaacaagaaaaacttgctgctatttattttttatgggcttgtgtgtgt 36942453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 54 - 94
Target Start/End: Original strand, 36942333 - 36942373
Alignment:
Q  54 ccttaatatcgtcatagtgcatgtttattttggtttaaagg 94  Q
    |||||||||||||||||| ||||||| ||||||||||||||    
T  36942333 ccttaatatcgtcatagtccatgtttgttttggtttaaagg 36942373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University