View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16668_high_39 (Length: 272)

Name: NF16668_high_39
Description: NF16668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16668_high_39
NF16668_high_39
[»] chr4 (2 HSPs)
chr4 (1-88)||(42799895-42799982)
chr4 (194-272)||(42799989-42800067)


Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 42799895 - 42799982
Alignment:
Q  1 cacattagcttagtgtgaaattgaagcatctaagaaaatcacttaaatagaacaggtatcatatcatttttagatatgaaaacactgt 88  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42799895 cacattagcttagtgtgaaattgaagcatctaagaaaatcacttaaatagaacaggtatcatatcatttttagatatgaaaacactgt 42799982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 194 - 272
Target Start/End: Original strand, 42799989 - 42800067
Alignment:
Q  194 aagtacaaaaattgattgtaaattttagattcatatgtcttttgatcttttcctcatttttattctgaaagtgaaataa 272  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42799989 aagtacaaaaattgattgtaaattttagattcatatgtcttttgatcttttcctcatttttattctgaaagtgaaataa 42800067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University