View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16668_high_35 (Length: 285)

Name: NF16668_high_35
Description: NF16668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16668_high_35
NF16668_high_35
[»] chr6 (3 HSPs)
chr6 (18-153)||(29001917-29002049)
chr6 (207-271)||(29001799-29001863)
chr6 (207-265)||(28962091-28962149)


Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 18 - 153
Target Start/End: Complemental strand, 29002049 - 29001917
Alignment:
Q  18 tgaagaacaattcaaagtctttaactttatcatcagaatctgtcaaggaataatagtcctccttgctgcattttttctgtgatgggtgagtgatgaattc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||    
T  29002049 tgaagaacaattcaaagtctttaactttatcatcagaatctgtcaaggaata---gtcctccttgctgcattttttctgtgatgggtgagtgatgaattc 29001953  T
Q  118 gtcacagaacaattcagagtctttgacataaacaac 153  Q
    ||||||||||||||||||||||||||||| ||||||    
T  29001952 gtcacagaacaattcagagtctttgacatcaacaac 29001917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 207 - 271
Target Start/End: Complemental strand, 29001863 - 29001799
Alignment:
Q  207 gatgtggttcattggtttggttttcttgctcaattggattggtggtagtttctaaaatggtggtt 271  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29001863 gatgtggttcattggtttggttttcttgctcaattggattggtggtagtttctaaaatggtggtt 29001799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 207 - 265
Target Start/End: Complemental strand, 28962149 - 28962091
Alignment:
Q  207 gatgtggttcattggtttggttttcttgctcaattggattggtggtagtttctaaaatg 265  Q
    |||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||    
T  28962149 gatgtggttcattggtttggttttctagctcaattgggttggtggtagtttctaaaatg 28962091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University